There are many factors that control efficiency of target mRNA cleavage in gene silencing experiments.
One of which is the guide miRNA loading efficiency - favourable binding of miRNA to hAgo2 can lower enthalpic cost of RISC complex assembly.
By applying NucleicNet on hAgo2, we have produced a Hidden Markov Model that assimilates effect of this factor.
Users can input comma-separated miRNA sequence(s) below to score their miRNA.
These sequences should be written from left to right from 5' end to 3' end.
They should not be shorter than 8 nt in length. E.g.
AAAUCCACAGCUACUUAUGCC,UAAAGGACGGUCAAGUUCAUG
correspond with two sequences. Typically, runs finishes within a minute. A less negative score correspond with a more favourable predicted binding.
Please wait and do not press refresh. For very long input, feel free to contact the developer directly to run the job.