Loading Efficiency Prediction on hAgo2

There are many factors that control efficiency of target mRNA cleavage in gene silencing experiments. One of which is the guide miRNA loading efficiency - favourable binding of miRNA to hAgo2 can lower enthalpic cost of RISC complex assembly. By applying NucleicNet on hAgo2, we have produced a Hidden Markov Model that assimilates effect of this factor.
Users can input comma-separated miRNA sequence(s) below to score their miRNA. These sequences should be written from left to right from 5' end to 3' end. They should not be shorter than 8 nt in length. E.g.
AAAUCCACAGCUACUUAUGCC,UAAAGGACGGUCAAGUUCAUG
correspond with two sequences. Typically, runs finishes within a minute. A less negative score correspond with a more favourable predicted binding.

Submit

This tool is for academic purposes and research use only. Any commercial use is subject for authorization from King Abdullah University of Science and Technology. Please contact us at ip@kaust.edu.sa.

Please wait and do not press refresh. For very long input, feel free to contact the developer directly to run the job.