Example of input FASTA sequence:
>Example_query_1
cagtttcatgatttcaatcaaaacctgtatggacataaggtgaatactttgttactttag
cgtcacagacatgaaattggtaagaccaattgacttcggcaagtggcttaagacaggaac
tcatggcctacagcaaaatccgccaaccaaaactctccgatgtgattgagcagcaactgg
agtttttgatcctcgaaggcactctccgcccgggcgaaaaactcccaccggaacgcgaac
tggcaaaacagtttgacgtctcccgtccctccttgcgtgaggcgattcaacgtctcgaag
cgaagggcttgttgcttcgtcgccagggtggcggcacttttgtccagagcagcctatggc
aaagcttcagcgatccgctggtggagctgctctccgaccatcctgagtcacagtatgact
tgctcgaaacacgacacgccctggaaggtatcgccgcttattacgccgcgctgcgtagta
ccgatgaagacaaggaacgcatccgtgaactccaccacgccatagagctggcgcagcagt
ctggcgatctggacgcggaatcaaacgccgtactccagtatcagattgccgtcaccgaag
cggcccacaatgtggttctgcttcatctgctaaggtgtatggagccgatgttggcccaga
atgtccgccagaacttcgaattgctctattcgcgtcgcgagatgctgccgctggtgagta
gtcaccgcacccgcatatttgaagcgattatggccggtaagccggaagaagcgcgcgaag
catcgcatcgccatctggcctttatcgaagaaattttgctcgacagaagtcgtgaagaga
gccgccgtgagcgttctctgcgtcgtctggagcaacgaaagaattagtgatttttctggt
aaaaattatccagaagatgttgtaaatcaagcgcatataaaagcgcggcaactaaacgta
gaacctgtcttattgagctttccggcgagagttcaatgggacaggttccagaaaactcaa
cgttattagatagataaggaataacccatgtcagaacgtttcccaaatgacgtggatccg
atcgaaactcgcgactggctc
Example of bTSSfinder output:
Program bTSSfinder
Search for sigma 70, 24, 32, 28 and 38 promoters
Input file with query sequence(s): example.fasta
Search parameters: for Escherichia coli
TSSs of different Sigma classes are processed separately
Search only on Sense Strand
Total scoring threshold for sigma70:   0.06
                            sigma24:   0.00
                            sigma32:   1.01
                            sigma28:   1.24
                            sigma38:   0.31


>Example_query_1
   Length of Query sequence:      1101
sigma24(+):    962   Score   1.94     -35 (933) gcatat >>> actaa -10 (955)
sigma32(+):    958   Score   1.93     -35 (924) aaatcaa >>> cgcggcaact -10 (953)
sigma28(+):    950   Score   1.91     -35 (915) agatgttg >>> gcatataa -10 (940)
sigma38(+):    949   Score   1.91     -35 (911) cagaag >>> tataaa -10 (941)
sigma70(+):    925   Score   1.91     -35 (887) gtgatt >>> gaagat -10 (918)
sigma28(+):    558   Score   1.72     -35 (523) tagagctg >>> ggcgatct -10 (550)
sigma24(+):    370   Score   1.89     -35 (334) gcactt >>> gcaaa -10 (363)
sigma32(+):    344   Score   1.82     -35 (309) ttgttgc >>> ggcggcactt -10 (339)
sigma38(+):    231   Score   1.85     -35 (193) tcgaag >>> aaaact -10 (223)
sigma70(+):    228   Score   1.89     -35 (193) tcgaag >>> gaaaaa -10 (221)
sigma28(+):    227   Score   1.94     -35 (194) cgaaggca >>> ggcgaaaa -10 (220)

   Total:     11 promoter(s) predicted
Example of BED format output:
Example_query_1	1	1101	sigma24_TSS1+	0	+	962	962	255,0,0	2	6,6	933,951
Example_query_1	1	1101	sigma32_TSS2+	0	+	958	958	255,0,0	2	6,6	924,944
Example_query_1	1	1101	sigma28_TSS3+	0	+	950	950	255,0,0	2	6,6	915,933
Example_query_1	1	1101	sigma38_TSS4+	0	+	949	949	255,0,0	2	6,6	911,936
Example_query_1	1	1101	sigma70_TSS5+	0	+	925	925	255,0,0	2	6,6	887,913
Example_query_1	1	1101	sigma28_TSS6+	0	+	558	558	255,0,0	2	6,6	523,543
Example_query_1	1	1101	sigma24_TSS7+	0	+	370	370	255,0,0	2	6,6	334,359
Example_query_1	1	1101	sigma32_TSS8+	0	+	344	344	255,0,0	2	6,6	309,330
Example_query_1	1	1101	sigma38_TSS9+	0	+	231	231	255,0,0	2	6,6	193,218
Example_query_1	1	1101	sigma70_TSS10+	0	+	228	228	255,0,0	2	6,6	193,216
Example_query_1	1	1101	sigma28_TSS11+	0	+	227	227	255,0,0	2	6,6	194,213
Example of GFF format output:
##gff-version 3.2.1
#Program bTSSfinder
#Search for sigma 70, 24, 32, 28 and 38 promoters
#Input file with query sequence(s): example.fasta
#Search parameters: for Escherichia coli
#TSSs of different Sigma classes are processed separately
#Search only on Sense Strand
#Total scoring threshold for sigma70:   0.06
#                            sigma24:   0.00
#                            sigma32:   1.01
#                            sigma28:   1.24
#                            sigma38:   0.31
##sequence-region Example_query_1        1     1101
Example_query_1	btssfinder	tss	962	962	1.94	+	.	promoter=sigma24;box35pos=933;box35seq=gcatat;box10pos=951;box10seq=actaa
Example_query_1	btssfinder	tss	958	958	1.93	+	.	promoter=sigma32;box35pos=924;box35seq=aaatcaa;box10pos=944;box10seq=cgcggcaact
Example_query_1	btssfinder	tss	950	950	1.91	+	.	promoter=sigma28;box35pos=915;box35seq=agatgttg;box10pos=933;box10seq=gcatataa
Example_query_1	btssfinder	tss	949	949	1.91	+	.	promoter=sigma38;box35pos=911;box35seq=cagaag;box10pos=936;box10seq=tataaa
Example_query_1	btssfinder	tss	925	925	1.91	+	.	promoter=sigma70;box35pos=887;box35seq=gtgatt;box10pos=913;box10seq=gaagat
Example_query_1	btssfinder	tss	558	558	1.72	+	.	promoter=sigma28;box35pos=523;box35seq=tagagctg;box10pos=543;box10seq=ggcgatct
Example_query_1	btssfinder	tss	370	370	1.89	+	.	promoter=sigma24;box35pos=334;box35seq=gcactt;box10pos=359;box10seq=gcaaa
Example_query_1	btssfinder	tss	344	344	1.82	+	.	promoter=sigma32;box35pos=309;box35seq=ttgttgc;box10pos=330;box10seq=ggcggcactt
Example_query_1	btssfinder	tss	231	231	1.85	+	.	promoter=sigma38;box35pos=193;box35seq=tcgaag;box10pos=218;box10seq=aaaact
Example_query_1	btssfinder	tss	228	228	1.89	+	.	promoter=sigma70;box35pos=193;box35seq=tcgaag;box10pos=216;box10seq=gaaaaa
Example_query_1	btssfinder	tss	227	227	1.94	+	.	promoter=sigma28;box35pos=194;box35seq=cgaaggca;box10pos=213;box10seq=ggcgaaaa